French bean severe leaf curl virus


Basic Information

Genus Capulavirus
NCBI Assembly GCF_000899975.1
Isolate India
Release date 2015/2/22
Submitter Akram,M., Naimuddin
Host
Download Genome |GFF3 |PEP |CDS

Genomic Organization


JBrowse


Genome

NC_018453
ACGGTTGCGCGTGTGGGCCCCACAGCCTTATCGTGGGGCCCACGTTTTGGCTTTTAGTCGAAGCGTAAGCAAGACGTCATGTCGGCCCCACAGCAATATAAAAGGAACCACAGTTGAGGATCTGAATGTTCTCGTAGAGGTCATTGGGACAACGTGTGGTGTATGGAATATTGCTCAGAATTTATATTCTGGTGGGAAGCCGCTGTTATTGTAATTGTTTTAGGTTTATTGATTTATATCAATGGAAAGTCGCTTATACTTAATCGAGGAATTGCCAGAGACGTACGGTCGTTTACAGGGATTTTGCACAGACTTATTCCTGGGCCGGATGATACAGAAGGCCCAAGACGAAGGACTTACGGGAGAAGTAACTCGTTACAGACTACTCAGACAGTGTTACCGCCAATCCCAGAGACGGAAAGAGAAATGGGCCATCAAAGTGGCCCAATTCAATGAAGACCTTGCCACTATTATAAATAGGGGTAGATGGGCCTCTGAAGAGGCCCAGAAACTCCTAGCGTACAAAAAAAAAATAGAAGATGGCTCGCACAAGATCGGGGAGACAGTATTCGGCCCAGGCCCCATCTTGGGGCCGGAAGAAGACAAGAACACCCCGTTCGAGACCTACACTGATTGGGCCGATTCGAAGGCCCAATTACCAAATCAAGACCCGCTATGCCCCCCACAGACCTCAGACTAAGATACACTCCTTGTCTGCGGCAAGGGTTGTATCTGGGTCGGATAATGGTTATGGATGGCACATCTCGGACGTTCCTATTGGATCGGGCTTTGAAGATAGGCATAGTGATAAAATTAGAATTTTAAATTTTAATTTTAAGTTACAGATGAGGACTTCTCAACAGGGACAGAACACGTCATGCTGGCATAACGTGTATTTGTTTTTAGTTAGAGACAATAGTGGAGGAACAGCTGTTCCGAAATTTAATTCAATATGTATGATGGATAATTCCAACCCTTCCACTGCTGAGATTGACCATGATTCGAAGGATCGTTTCACGATTATGAGAAGATGGAGATTCCAGTTCAAAGGAAACAGCACATCTGGATCCGTTGCTTATGACTGTGCTAGGAATACTTATGATTTTAGGAAATTTGTTAAATTAAGTTCAATTACTGAATTTAAGAGTGCTACAAGTGGATCTTATGCTAATACGCAAAAGAACGCTTGGGTATTGTATTTTGTTCCTCAGACGTACGATATGACTGTTGACGGTCATTGTACGATCAAATATGTATCAATTGTGTAATCAATTAATAAAAAATAATTGAATTATGATATCGCTATCAATCATCACACGCTATAATACCAGATAATCAGAAAAACGATACGATAATAGTAATATAATCAAAGTCGAAGACTTTTAATTAATTAAAAGAAAGGATCTTTTATTTCCACATGAATTACATTGGATAAGGACCATTCGTACATTTCACTGCCCATTAATGCAGCTTTGTATGATTGATCTGGATTACACAGTACAATGGTTGGAATTCTACATTTTTTTCTATATTTTTCGTTGACTGTAAAATCCTTTTGACATCCTAGTAATTCTTTTTTACATGGAAGAAATTGAAAAGGAATATCATCTATGACGGTGTAAGTAGCAAAATTATTCCACACACTAAAATCAACACCCCCACAAAAATAATTATGTAGACCCATGCTCCTGGCCCATGCTGTTTTGCCTGTTTTTGTTGGGCCAAACAATTATTAGAGTCACTGGGCGGTCCGGTCTCTGATCCTGAAAATGATTGTACAACAGGATCTTCAGAATTACCAATCCATTCATCAGTAATAAAGTCTTCTGTTAAATTATGAGCCCATTGCATATCTGTTACTGATATTTCTGGTTGAACTAATTGCATGGATTGAAGACTTACTGTGAATAAGTTGGTGTCTGCCCATTCTCTAATGGGCTCGGGTACATTATTGAACACTGTCCATTTGGGAATGTACACACTAGGTTGCTCTGGCCACTTACTATTTGCTGCATATTCGAGATTTCGTAATTGAGTTGCCCAGACATATGGTTGCTCAATCTGGACTCTACCGAGAAACTCGGACTTGGAGGTGGATTCATTGATGATGTTTGTCCATATTGAATCCCTGCTCTTCTTAGGGCTTCTTCTACTTGCCCTAAGTATTCCTCGTTCCTCAAATTGTCCTCCCTTGGCAATATAGTCTGCCACATCAGCATCTCTTCTTGGGACCTGGCAATTGGGGTGGTAAACCCCAGTTCTGTTTGGGTCTGAGATGTCAAAATATCTCTGTGATGTGGTGTTGAACCTCTTGTCCAGTTGGACAAGACAGTGAAGGTGTGGCTCACCGTCCTGGTGATTCTCCGTACAGACCCTAGCATATATAGGATTAAAATTCTTTAATAATTGATATAAGTAATCAATTACGAAAAGTGGAGTTAAGGGGCATTTTGGGTAAGTCAAAAAAATAGACTTACCCTGGAGACGGAAGGAGTTGTTGTTGCGTCGAGGCATGATGCGTATAAAAATAATGGTAATAGAAGGGAGCTCAAGATTCGATTTGGCAATTCTTTATTCTACAAGGTTTTGCGTGAGAAGTGAGCTCCCTCCTGTTGCGTTATATAATACAAATGGACGGCTGTGATTTATCCACGTGTCTTTCATCTTGCGAGCCGACAAAAGTGAGTGGGTACTTTTACTTTATTAAATAAAGTTGTTTGAATGCGGACCGAAGGTCCGTAGTGCGGTTCTCACGCGCAACCTTTAATATT

Gene Information

NCBI Accession YP_006590004.1
Location 540-1268
Gene Name CP
Protein Name coat protein
Coding Region ATGGCTCGCACAAGATCGGGGAGACAGTATTCGGCCCAGGCCCCATCTTGGGGCCGGAAGAAGACAAGAACACCCCGTTCGAGACCTACACTGATTGGGCCGATTCGAAGGCCCAATTACCAAATCAAGACCCGCTATGCCCCCCACAGACCTCAGACTAAGATACACTCCTTGTCTGCGGCAAGGGTTGTATCTGGGTCGGATAATGGTTATGGATGGCACATCTCGGACGTTCCTATTGGATCGGGCTTTGAAGATAGGCATAGTGATAAAATTAGAATTTTAAATTTTAATTTTAAGTTACAGATGAGGACTTCTCAACAGGGACAGAACACGTCATGCTGGCATAACGTGTATTTGTTTTTAGTTAGAGACAATAGTGGAGGAACAGCTGTTCCGAAATTTAATTCAATATGTATGATGGATAATTCCAACCCTTCCACTGCTGAGATTGACCATGATTCGAAGGATCGTTTCACGATTATGAGAAGATGGAGATTCCAGTTCAAAGGAAACAGCACATCTGGATCCGTTGCTTATGACTGTGCTAGGAATACTTATGATTTTAGGAAATTTGTTAAATTAAGTTCAATTACTGAATTTAAGAGTGCTACAAGTGGATCTTATGCTAATACGCAAAAGAACGCTTGGGTATTGTATTTTGTTCCTCAGACGTACGATATGACTGTTGACGGTCATTGTACGATCAAATATGTATCAATTGTGTAA
Protein Sequence MARTRSGRQYSAQAPSWGRKKTRTPRSRPTLIGPIRRPNYQIKTRYAPHRPQTKIHSLSAARVVSGSDNGYGWHISDVPIGSGFEDRHSDKIRILNFNFKLQMRTSQQGQNTSCWHNVYLFLVRDNSGGTAVPKFNSICMMDNSNPSTAEIDHDSKDRFTIMRRWRFQFKGNSTSGSVAYDCARNTYDFRKFVKLSSITEFKSATSGSYANTQKNAWVLYFVPQTYDMTVDGHCTIKYVSIV

NCBI Accession YP_006590005.1
Location 1609-2514
Gene Name C1:C2
Protein Name replication associated protein
Coding Region ATGCCTCGACGCAACAACAACTCCTTCCGTCTCCAGGGTAAGTCTATTTTTTTGACTTACCCAAAATGCCCCTTAACTCCACTTTTCGTAATTGATTACTTATATCAATTATTAAAGAATTTTAATCCTATATATGCTAGGGTCTGTACGGAGAATCACCAGGACGGTGAGCCACACCTTCACTGTCTTGTCCAACTGGACAAGAGGTTCAACACCACATCACAGAGATATTTTGACATCTCAGACCCAAACAGAACTGGGGTTTACCACCCCAATTGCCAGGTCCCAAGAAGAGATGCTGATGTGGCAGACTATATTGCCAAGGGAGGACAATTTGAGGAACGAGGAATACTTAGGGCAAGTAGAAGAAGCCCTAAGAAGAGCAGGGATTCAATATGGACAAACATCATCAATGAATCCACCTCCAAGTCCGAGTTTCTCGGTAGAGTCCAGATTGAGCAACCATATGTCTGGGCAACTCAATTACGAAATCTCGAATATGCAGCAAATAGTAAGTGGCCAGAGCAACCTAGTGTGTACATTCCCAAATGGACAGTGTTCAATAATGTACCCGAGCCCATTAGAGAATGGGCAGACACCAACTTATTCACAGTAAGTCTTCAATCCATGCAATTAGTTCAACCAGAAATATCAGTAACAGATATGCAATGGGCTCATAATTTAACAGAAGACTTTATTACTGATGAATGGATTGGTAATTCTGAAGATCCTGTTGTACAATCATTTTCAGGATCAGAGACCGGACCGCCCAGTGACTCTAATAATTGTTTGGCCCAACAAAAACAGGCAAAACAGCATGGGCCAGGAGCATGGGTCTACATAATTATTTTTGTGGGGGTGTTGATTTTAGTGTGTGGAATAATTTTGCTACTTACACCGTCATAG
Protein Sequence MPRRNNNSFRLQGKSIFLTYPKCPLTPLFVIDYLYQLLKNFNPIYARVCTENHQDGEPHLHCLVQLDKRFNTTSQRYFDISDPNRTGVYHPNCQVPRRDADVADYIAKGGQFEERGILRASRRSPKKSRDSIWTNIINESTSKSEFLGRVQIEQPYVWATQLRNLEYAANSKWPEQPSVYIPKWTVFNNVPEPIREWADTNLFTVSLQSMQLVQPEISVTDMQWAHNLTEDFITDEWIGNSEDPVVQSFSGSETGPPSDSNNCLAQQKQAKQHGPGAWVYIIIFVGVLILVCGIILLLTPS

References More References in PubMed

1

Tomato Yellow Leaf Curl Virus-Is Causes a Novel Disease of Common Bean and Severe Epidemics in Tomato in Spain.

Navas-Castillo J, et al.  Plant Dis. 1999 Jan;83(1):29-32. doi: 10.1094/PDIS.1999.83.1.29.

PMID: 30845435

2

First Report of Tomato yellow leaf curl virus Infecting Common Bean (Phaseolus vulgaris) in Greece.

Papayiannis LC, et al.  Plant Dis. 2007 Apr;91(4):465. doi: 10.1094/PDIS-91-4-0465C.

PMID: 30781210

3

Screening Common Bean (Phaseolus vulgaris) for Resistance to Tomato yellow leaf curl virus.

Lapidot M.  Plant Dis. 2002 Apr;86(4):429-432. doi: 10.1094/PDIS.2002.86.4.429.

PMID: 30818720

4

Capulavirus and Grablovirus: two new genera in the family Geminiviridae.

Varsani A, et al.  Arch Virol. 2017 Jun;162(6):1819-1831. doi: 10.1007/s00705-017-3268-6. Epub 2017 Feb 17.

PMID: 28213872

5

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island.

Peterschmitt M, et al.  Plant Dis. 1999 Mar;83(3):303. doi: 10.1094/PDIS.1999.83.3.303B.

PMID: 30845523

6

Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus.

Morilla G, et al.  Phytopathology. 2005 Sep;95(9):1089-97. doi: 10.1094/PHYTO-95-1089.

PMID: 18943307

7

Genome characterization and diversity of trifolium virus 1: identification of a novel legume-infecting capulavirus.

Ma Y, et al.  Arch Virol. 2021 Sep;166(9):2573-2578. doi: 10.1007/s00705-021-05135-6. Epub 2021 Jun 20.

PMID: 34148142

8

Weed-infecting viruses in a tropical agroecosystem present different threats to crops and evolutionary histories.

Maliano MR, et al.  PLoS One. 2021 Apr 28;16(4):e0250066. doi: 10.1371/journal.pone.0250066. eCollection 2021.

PMID: 33909644

9

A New Begomovirus Species Causing Tomato Leaf Curl Disease in Varanasi, India.

Chakraborty S, et al.  Plant Dis. 2003 Mar;87(3):313. doi: 10.1094/PDIS.2003.87.3.313A.

PMID: 30812767

10

Infectivity analysis of a blackgram isolate of Mungbean yellow mosaic virus and genetic assortment with MYMIV in selective hosts.

Haq QM, et al.  Virus Genes. 2011 Jun;42(3):429-39. doi: 10.1007/s11262-011-0591-y. Epub 2011 Mar 6.

PMID: 21380756