Tomato golden leaf distortion virus


Basic Information

Genus Begomovirus
NCBI Assembly GCF_002823965.1
Isolate Brazil
Release date 2019/6/28
Submitter Fonseca,M.E.N., Boiteux,L.S., Fernandes,N.A.N., Costa,A.F., Lima-Neto,A.F.
Host
Download Genome

Genomic Organization


Genome

NC_043122
ACCGGATGGCCGCCCGAATTTTTGGGGGTGGGGCCCCAAAGCACTCGCGCATTTTGTGCATTTATGGTCCCACTATGCGTTCAAGCAGAGTGGCGCCTCAACGCTTAGTTATTTGAAAGTACTTGGTGGGCAAGTTTTGTACAGGTGTATAAATCAGGACCCCACATAATGGGGTCGACAGTCTTTAATTCAAAATGTCTAAGCGGGCTGCCCCCTCGTGGCGCTCGATGGCGGGAATCTCGAAGGTTAGCCGCTCTCTCAATTTTTCACCTCGTGGAGGTATTAATCCCAGAATTGATAGGGCCGCAGCCTGGGTTAAATAAGGGCCCATGTACAGAAAGCCCAGGATATATCGGGCCTTCAGATCGGCGGATGTTCCTAAAGGGTGTGAGGGGCCTTGTAAGGTCCAGACTTATGAACAGCGCCACGATATCGCCCATTCTGGGAAGGTGCTGTGCATCTCCGATGTGACTCGCGGTAGCGGTATAACTCACCGTGTCGGTAAGCGATTCTGTGTGAAGTCCGTTTACATTTTAGGTAAGGTATGGATGGACGACAACATCAAGTTGAGGAACCACACTAACACCGTGATGTTCTGGTTGGTTAGAGACCGGAGACCGTATGGCACTCCCATGGATTTCGGACAGGTGTTCAACCTGTTTGATAATGAGCCCAGTACTGCCACCGTGAAGAACGATCTCCGTGATCGTTTCCAAGTGATGCATAGGTTCCACACGACGGTGACTGGTGGTCAGTATGCTGCCAAGGAGCAGGCGCTGGTGAAGCGTTTCTGGAAGGTCAACACTCATGTTACCTACAACCATCAGGAGGCCGCGAAGTACGAGAATCATACGGAGAACGCCCTGTTATTGTATATGGCATGTACACATGCGTCTAACCCCGTGTATGCAACCCTGAAGATCCGGATCTATTTTTATGATTCGGTGTCTTAATAATAAATTTTTGAATTTTATTGAATGATTTTCGAGTACAGCACTTACATATGATCTGTCTGTTGCAAAGCGAACAGCCCGGATTACATTATTAATGGAAATAACACCTAATCTATCTAAATACAATAACACAAAATGCTTAAATCTATGTAAATAATTCGTCCCAGAAACTGTCTGTGAAGTCGTCCAGACTTGGAAGTTGAAGAACGCCTTGTGGAGATCCAACGCTCTCCGCAGGTTGTGGTTGAACCGTATCTGGACGTGGAATATCCTGGTGTTGGTGTATATTGGGTCTTCCACCCTGGTTATCTTGAAATAGAGGGGATTTGTTATTTCCCAGATATACGCGCCATTCTCTGCTTGAGGCGCAGTGATGAGTTCCCCTGTGCGTGAATCCATTGGTTGGCGCAATTGATGTGGATGAAAATGGAGCAGCCGCAGTTGAGATCTATTCGTCTACGGCGAGTTGCCCTGCGTTTGGCTGCTCTGTGTTGGACTTTGATAGAGAGGGGATGTGAGGAAGACGAACTTTGCATTATGTATAGTCCAGTCATTTAGTGAAACATTCTCTTGTTTCTCCAAGAACTCTTTATAACTGGACCCTTCTCCCTGGATTGCAAAGCACAATTGAGGGTATGCCTCCTTTAATTTGAACTGGCTTGCCGTACTTGCAATTTGATTGCCAGTCCCTTTGGGCCCCAAGCAGTTCTTTCCAGTGCTGTAGCTGTAGGTATTGCGGAGTGACATCATCAATGACGTTATACTCCACGTCATTTGAGTAAACCCTAGAATTGAAATGTAGGTGTCCGCACAAATAATTGTGGACCCGTAAAGCACGTGCCCACATCGTCTTCCCCGTTCGACTATCACCCTCGACGATAATACTAATAGGTCTCTCCGGCCGCGCAGCGGCACCTCTCCCAAAATAATCATCGGCCCACTCTTGCATGTCGTCGGGAACGGTATTGAATGAGGAGAGGTGAAACGGAGGAACCCATGGCTCCGGAGCCTTTGCAAAGATACGTTGTAGATTAGAACGTATGTTATGATTTTGAAGGACGAAGTCTTTTGGTTGTTCCTCCCTGAATATATTGAGGGCCTCTGAGACGGAGCCAGCGTTGAGGACCTTGGCATACGTGTCGTTGGCAGATTGCTGACCTCCTCTAGCTGATCTGCCGTCGATCTGGAAAAGTACCATGAGCAATGAAGTCTCCGTCTTTCTCCACGTATGCCGTAACATCGGAGCTTCTCTTTAGCTCCCTGAATGTTCGGATGGAAATGTGCTGACCTGGTTGGGGATACCAAGTCGAAGAATCTGTGGTTTGTGCACTGATATTTTCCTTCGAACTGGATGAGCACATGGAGATGAGGCTCCCCATCGTCGTGGAGTTCTCTTGCAACTCTAATGAATAATTTGTTAGTTGGGGTGTTTAGGTTTTGTAATTGGTAAAGTGCTTCCTCTTTGGTGAGAGAGCACTGTGGATAAGTGAGGAAATAGTTTTTGGAGTTAATTTTGAAACGTTTGGGTGGTGGCATTTTAGTAATAAGAGGTTGTACCCCGATTGAGCTCTCGCAAACTTGCTCTAGCAATCGGTGTAAAGGGGTACAATATATACTTGAACCCTCATTAGAACTTTCAATTTCGTTCACACACGTGGCGGCCATCCGGTATAACAT


References More References in PubMed

1

Nanopore sequencing of tomato mottle leaf distortion virus, a new bipartite begomovirus infecting tomato in Brazil.

Martins TP, et al.  Arch Virol. 2021 Nov;166(11):3217-3220. doi: 10.1007/s00705-021-05220-w. Epub 2021 Sep 8.

PMID: 34498121

2

Tomato chlorotic leaf distortion virus, a new bipartite begomovirus infecting Solanum lycopersicum and Capsicum chinense in Venezuela.

Zambrano K, et al.  Arch Virol. 2011 Dec;156(12):2263-6. doi: 10.1007/s00705-011-1093-x. Epub 2011 Aug 19.

PMID: 21853328

3

Molecular characterization and experimental host range of an isolate of Wissadula golden mosaic St. Thomas virus.

Collins AM, et al.  Virus Genes. 2009 Dec;39(3):387-95. doi: 10.1007/s11262-009-0401-y. Epub 2009 Sep 20.

PMID: 19768650

4

Complete genome sequence of a new bipartite begomovirus infecting tomato in Brazil.

Rego-Machado CM, et al.  Arch Virol. 2019 Nov;164(11):2873-2875. doi: 10.1007/s00705-019-04380-0. Epub 2019 Aug 20.

PMID: 31432269

5

A New Geminivirus Associated with Tomato in the State of São Paulo, Brazil.

Faria JC, et al.  Plant Dis. 1997 Apr;81(4):423. doi: 10.1094/PDIS.1997.81.4.423B.

PMID: 30861828

6

Genetic and Phenotypic Variation of the Pepper golden mosaic virus Complex.

Brown JK, et al.  Phytopathology. 2005 Oct;95(10):1217-24. doi: 10.1094/PHYTO-95-1217.

PMID: 18943475

7

The distinct disease phenotypes of the common and yellow vein strains of Tomato golden mosaic virus are determined by nucleotide differences in the 3'-terminal region of the gene encoding the movement protein.

Saunders K, et al.  J Gen Virol. 2001 Jan;82(Pt 1):45-51. doi: 10.1099/0022-1317-82-1-45.

PMID: 11125157

8

Preliminary identification and coat protein gene phylogenetic relationships of begomoviruses associated with native flora and cultivated plants from the Yucatan Peninsula of Mexico.

Hernández-Zepeda C, et al.  Virus Genes. 2007 Dec;35(3):825-33. doi: 10.1007/s11262-007-0149-1. Epub 2007 Aug 8.

PMID: 17682933

9

Partial Characterization of Two Whitefly-Transmitted Geminiviruses Infecting Tomatoes in Venezuela.

Guzman P, et al.  Plant Dis. 1997 Mar;81(3):312. doi: 10.1094/PDIS.1997.81.3.312A.

PMID: 30861780

10

Circomics of Cuban geminiviruses reveals the first alpha-satellite DNA in the Caribbean.

Jeske H, et al.  Virus Genes. 2014 Oct;49(2):312-24. doi: 10.1007/s11262-014-1090-8. Epub 2014 Jun 19.

PMID: 24943118